|
Ribobio co
circrna-umad1 primers ![]() Circrna Umad1 Primers, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/circrna+umad1+primers/pmc07540136-158-6-13 Average 90 stars, based on 1 article reviews
circrna-umad1 primers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Arraystar inc
super rna labeling kit ![]() Super Rna Labeling Kit, supplied by Arraystar inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/super+rna+labeling+kit/pmc07049409-119-13-12 Average 90 stars, based on 1 article reviews
super rna labeling kit - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
New England Biolabs
ggcgtttaaacaaacaataagtctgggagag ![]() Ggcgtttaaacaaacaataagtctgggagag, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/PmeI/pmc06507086-323-22-48 Average 98 stars, based on 1 article reviews
ggcgtttaaacaaacaataagtctgggagag - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ipo8 hs00183533 m1 ![]() Gene Exp Ipo8 Hs00183533 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/Gene+Exp%2E+IPO8%2C+Hs00183533_m1/haque_shahnaz__2020__circular_rnas_new_players_in_ageing_and_age_related_chronic_disease-1138-75-76 Average 99 stars, based on 1 article reviews
gene exp ipo8 hs00183533 m1 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Sangon Biotech
circrna primers ![]() Circrna Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/circrna/pmc12421446-204-0-21 Average 86 stars, based on 1 article reviews
circrna primers - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
circrna ![]() Circrna, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/circrna/pmc11382869-137-0-0 Average 90 stars, based on 1 article reviews
circrna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
small interfering rna sirna pcbp1 human sirna oligo duplex ![]() Small Interfering Rna Sirna Pcbp1 Human Sirna Oligo Duplex, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/PCBP1+Human+siRNA+Oligo+Duplex/pmc12865031-487-6-18 Average 94 stars, based on 1 article reviews
small interfering rna sirna pcbp1 human sirna oligo duplex - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Arraystar inc
random priming arraystar super rna labeling kit ![]() Random Priming Arraystar Super Rna Labeling Kit, supplied by Arraystar inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/random+priming+method+arraystar+super+rna+labeling+kit/pmc09606334-40-12-11 Average 90 stars, based on 1 article reviews
random priming arraystar super rna labeling kit - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
PrimerDesign Inc
circrna primer design ![]() Circrna Primer Design, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/circrna+primer+design/pmc08100645-17-4-5 Average 90 stars, based on 1 article reviews
circrna primer design - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
5 PRIME
circrna ![]() Circrna, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/circrna/pmc06938940__mmc6-152-67-18 Average 90 stars, based on 1 article reviews
circrna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
tiangen biotech co
rna analysis ![]() Rna Analysis, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/miRcute+Plus+miRNA+First-Strand+cDNA+Kit/pmc08146108-54-33-47 Average 99 stars, based on 1 article reviews
rna analysis - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
GenScript corporation
primers for circrnas ![]() Primers For Circrnas, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/customized+primer+sequences+for+circrna/primers+for+circrnas/pmc07732319-118-4-8 Average 90 stars, based on 1 article reviews
primers for circrnas - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: American Journal of Translational Research
Article Title: The combination of circRNA-UMAD1 and Galectin-3 in peripheral circulation is a co-biomarker for predicting lymph node metastasis of thyroid carcinoma
doi:
Figure Lengend Snippet: Hsa-circRNA-UMAD1 acts as a miRNA sponge to directly target miR-873. Venn diagram identified circRNA-UMAD1 as a candidate sponge for miR-873 through prediction by a circRNA website tool and circRNA sequencing data (A). Three circRNAs were expressed in normal tissues from HPA-RNA sequencing (B). The sequence alignment of the human circRNA sequence and miR-873 is shown. The mutated sequence in the corresponding binding sites of circRNA UMAD1 that was used to generate the firefly luciferase reporter constructs is shown underneath the miR-873 set (C). A luciferase reporter assay was performed to detect the activity of circRNA UMAD1 in HEK293 cells cotransfected with miR-873 or scramble control and circRNA UMAD1 or vector (D). The correlation between the expression of circRNA UMAD1 and miR-873 was evaluated by Person’s correlation test in 50 samples (r = -0.31, P = 0.023) (E).
Article Snippet: The forward and reverse sequences of
Techniques: Sequencing, RNA Sequencing Assay, Binding Assay, Luciferase, Construct, Reporter Assay, Activity Assay, Plasmid Preparation, Expressing
Journal: American Journal of Translational Research
Article Title: The combination of circRNA-UMAD1 and Galectin-3 in peripheral circulation is a co-biomarker for predicting lymph node metastasis of thyroid carcinoma
doi:
Figure Lengend Snippet: CircRNA UMAD1 is associated with LNM and Gal3 expression. Expression of hsa-circ-UMAD1 quantified by at least three independent qRT-PCR experiments in the cohort comparing non-LNM tumors (absent, n = 23) and LNM tumors (present, n = 27). Unpaired t-tests were performed to identify significant differences. The relative expression level of circRNA UMAD1 was normalized to the level of β-actin (A). CircRNA UMAD1 expression was significantly related to LNM and primary side location based on univariant analysis of 50 PTC patients, which is described in Table 1 (B). The correlation between the expression of circRNA UMAD1 and Gal3 was evaluated by Person’s correlation test (r = 0.35, P = 0.00138) (C). All data are expressed as the median ± range with three independent experiments.
Article Snippet: The forward and reverse sequences of
Techniques: Expressing, Quantitative RT-PCR
Journal: American Journal of Translational Research
Article Title: The combination of circRNA-UMAD1 and Galectin-3 in peripheral circulation is a co-biomarker for predicting lymph node metastasis of thyroid carcinoma
doi:
Figure Lengend Snippet: Relationship between circRNA UMAD1 expression and pathological features in PTC patients with or without LNM
Article Snippet: The forward and reverse sequences of
Techniques: Expressing
Journal: American Journal of Translational Research
Article Title: The combination of circRNA-UMAD1 and Galectin-3 in peripheral circulation is a co-biomarker for predicting lymph node metastasis of thyroid carcinoma
doi:
Figure Lengend Snippet: ROC curves for individual biomarkers circRNA UMAD1 and Gal3 or combination. ROC curve analysis of circRNA UMAD1 calculates the best cutoff point to discriminate between the LNM and primary tumor groups. The area under the curve (AUC) (SE) = 0.718 (0.072); 95% confidence interval was 0.576 to 0.86; P = 0.0084 (A). ROC curve analysis of Gal3 between these two groups. AUC (SE) = 0.825 (0.061); 95% confidence interval was 0.704 to 0.945; P<0.001 (B). ROC curve analysis of circRNA UMAD1 combined with Gal3 for distinguishing patients in the LNM vs. primary tumor groups. AUC (SE) = 0.87 (0.051); 95% confidence interval was 0.766 to 0.97; P<0.001 (C). Likelihood ratio = 3.75. P<0.01, ROC, receiver operating characteristic; SE, standard error.
Article Snippet: The forward and reverse sequences of
Techniques:
Journal: Asian Pacific Journal of Cancer Prevention : APJCP
Article Title: Identification of Circular RNAs as Biomarker Candidates in Lung Cancer Treatment
doi: 10.31557/APJCP.2024.25.6.2147
Figure Lengend Snippet: circRNA Genes Expressed in All Experimental Groups. A) All circRNAs expressed were shown in the venn diagram. B) Expression levels of circRNAs detected in all experimental groups. Gene expression level was calculated using the ΔΔCt method. Statistics were performed using one-way analysis of variance (ANOVA) test for comparisons * p < 0.05; ** p < 0.01; *** p < 0.001. ns: not significant. Analyzes was performed in RT-qPCR as triplicate. (carboplatin; CP, pemetrexed; PX).
Article Snippet:
Techniques: Expressing, Gene Expression, Quantitative RT-PCR
Journal: Asian Pacific Journal of Cancer Prevention : APJCP
Article Title: Identification of Circular RNAs as Biomarker Candidates in Lung Cancer Treatment
doi: 10.31557/APJCP.2024.25.6.2147
Figure Lengend Snippet: circRNA Genes Expressed Only in the Treatment Groups. A) Expression levels of circRNAs detected in the three treatment groups. B) Expression levels of circRNAs detected only in CP and PX treatments (carboplatin; CP, pemetrexed; PX).
Article Snippet:
Techniques: Expressing
Journal: Asian Pacific Journal of Cancer Prevention : APJCP
Article Title: Identification of Circular RNAs as Biomarker Candidates in Lung Cancer Treatment
doi: 10.31557/APJCP.2024.25.6.2147
Figure Lengend Snippet: circRNAs Silenced by Treatment. A) The expressions of circRNA inhibited by only pemetrexed treatment. B) The expressions of circRNA inhibited by only carboplatin treatment. C) circRNAs affected by combination therapy (carboplatin; CP, pemetrexed; PX).
Article Snippet:
Techniques:
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: A Schematic illustration of i-motif DNA structure, highlighting intercalation of C:CH + base pairs between two Cs, where one C is in its protonated form (CH + ). B MEME (Multiple Expectation maximizations for Motif Elicitation)-based motif-enrichment analysis showing significant enrichment of C-rich sequences in PCBP1-bound ChIP-seq peaks from human K562 ( GSE174944 ) and HepG2 ( GSE106035 ) cells; E -value indicates statistical significance. C Heatmap profile centered around TSS (transcription start site) for PCBP1-ChIP-seq peaks. Read counts were extracted within a region spanning ±2 kb around TSS. The gradient blue-to-yellow color indicates high-to-low counts in the corresponding region. Plots at the top of the heatmaps show the normalized read counts at genomic regions centered at TSS. D Schematic diagram of iMab-ChIP, illustrating iMab binding to i-motif regions in crosslinked chromatin, captured by anti-FLAG antibody on magnetic beads. Created in BioRender. Sabouri, N. (2026) https://BioRender.com/84wqzkv . E Quantification of iMab-ChIP efficiency at i-motif-harboring promoters of cMYC , BCL2 oncogenes and insulin gene ILPR versus several non-i-motif negative control sites ( ARHGEF10L , GAPDH , HTR6 , IL36G ) in HeLa cells. The y -axis shows fold enrichment over these negative regions. F IGV (Integrative Genomic Viewer) tracks visualizing ChIP-seq data of PCBP1-bound regions at i-motif-containing promoters in K562 and HepG2 cells. Each track shows the signal intensity range, with a scale noted in brackets for each genomic region, indicating the level of PCBP1 occupancy across those genomic regions for different cell types. Highlighted light gray regions overlap with corresponding i-motif-forming sequences under investigation. G Quantification of PCBP1-ChIP at three i-motif-containing promoters ( cMYC , BCL2 , ILPR ) compared to the HTR6 control site in HeLa cells to determine fold enrichment over the HTR6 site. ChIP-qPCR bar plots in ( E , G ) represent the means ± SD of three technical replicates ( n = 3) and error bars indicate standard deviation (SD). Raw C t values from input, IP, and mock (IgG) samples obtained from three independent biological replicates, each measured with three technical replicates, are provided in Supplementary Data and .
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: ChIP-sequencing, Binding Assay, Magnetic Beads, Negative Control, Control, ChIP-qPCR, Standard Deviation
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: A Thermal-shift assay of PCBP1 at different pH levels. The y -axis shows \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$-\frac{{dF}}{{dT}}$$\end{document} − d F d T representing the negative derivative of Sypro-Orange fluorescence signal with respect to temperature; melting temperature ( T m ) defined by negative maxima at different pH values. B pH T values indicate the transition pH, at which 50% of i-motifs remain folded at 25 °C, derived from CD spectroscopy for cMYC , BCL2 , ILPR , and hTeloC-i-motifs. C EMSA gels at pH 8.0 and D at pH 6.4, showing 5′-Cy5-labeled iMfs with band-shifts upon incubation with increasing concentrations of recombinantly purified PCBP1. E Sigmoidal curves from MST binding experiments between PCBP1 and iMfs at pH 8.0, 7.0, and 6.4. F K D,app estimated from MST binding curves for iMfs at pH 8.0, 7.0, and 6.4. Statistical significance and p value calculated using two-tailed Student’s t -test, where p values < 0.05 are considered statistically significant. G Competitive EMSA showing displacement of iMfs-PCBP1 complexes with increasing concentration of C-RNA performed at pH 6.4 and 8.0. Native gels (top) and densitometric analyses of gels (bottom). Data in ( B , E , F , G ) represent the mean ± SD from three independent biological replicates ( n = 3). Error bars indicate standard deviation. Uncropped and unprocessed gel images corresponding to EMSA experiments shown in ( C , D , G ) are provided in the .
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: Thermal Shift Assay, Fluorescence, Derivative Assay, Circular Dichroism, Labeling, Incubation, Purification, Binding Assay, Two Tailed Test, Concentration Assay, Standard Deviation
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: A 1 H NMR spectra. Broadening of imino proton resonances (15–16 ppm defining C:CH + bonds) of cMYC -i-motif during PCBP1 titrations. B CD spectra of cMYC and BCL2 -i-motifs upon PCBP1 titrations, with highlighted regions showing blue-shift (with arrows) and hypochromic effects. C Schematic diagram of i-motif-destabilization trapping assay. PCBP1 and i-motifs are incubated for 15 min, followed by the addition of complementary strands or traps; reactions were stopped at various time points until 20 min. PCBP1-driven i-motif unfolding led to increased hybridization rates ( k ) between i-motifs and their corresponding complementary strands. Created in BioRender. Sabouri, N. (2026) https://BioRender.com/oazozsm . D Native PAGE visualizing aliquots of hybridization reactions at different time intervals upto 20 min, alongside negative control (i-motifs without complementary strands) and positive controls (hybridized duplex for 24 h) in the absence and presence of PCBP1 in 1:1 molar ratio. Uncropped and unprocessed gel images corresponding to native PAGE experiments are provided in the . Created in BioRender. Sabouri, N. (2026) https://BioRender.com/oazozsm . E Densitometric analysis of i-motif-trapping with and without PCBP1. Normalized intensities of hybridized fractions calculated from three independent biological replicates ( n = 3) at different time points, fitted to single-exponential function equations. Error bands/bars denote standard deviation. F Fold enrichment of iMab-ChIP at i-motif-harboring promoters ( cMYC , BCL2 , ILPR ) versus non-i-motif control site ( HTR6 ); error bars from standard deviation of three technical replicates ( n = 3). Statistical differences and p values between control and PCBP-KD determined by one-way ANOVA followed by Tukey–Kramer post hoc test, where p values < 0.05, are considered statistically significant. Raw C t values from input, IP, and mock (IgG) samples obtained from three independent biological replicates, each measured with three technical replicates, are provided in Supplementary Data .
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: Circular Dichroism, Incubation, Hybridization, Clear Native PAGE, Negative Control, Standard Deviation, Control
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: A Schematic of primer extension assay on i-motif-forming templates, where i-motif formation sterically blocks or slows DNA polymerase progression. Created in BioRender. Sabouri, N. (2026) https://BioRender.com/vwd8yby . B Primer extension templates containing i-motif-forming sequences, AT-linker, and TET (tetrachlorofluorescein)-labeled primer complementary sequences. G-to-T mutations are marked in red. Pausing signals are highlighted in pink boxes. C Primer extension assay with cMYC -i-motif-forming template at various time points until 20 min. AT-linker preceding cMYC -i-motif and sequence provided with pausing signals (red, asterisk), full-length products, and primer. D Densitometric analyses of full-length replication product formation over time in the presence of PCBP1; results expressed as means ± SD from three biological replicates ( n = 3), fitted to single-exponential function equations to calculate the rate of reaction ( k ). Error bars/bands denote standard deviation. E Imino proton NMR resonances (15–16 ppm) and Watson-Crick (W-C) pairing (12–14 ppm) of wild-type and mutated BCL2 -i-motifs. F Primer extension assay with wild-type BCL2 -i-motif-forming template ( BCL2 -wt) at different time points. AT-linker preceding BCL2- wt-i-motif, the template sequence with three pausing signals highlighted with red asterisks; full-length product and primer are shown with potential involvement of G10 and G12 in hairpin formation that blocks PCBP1. Primer extension assays involving F BCL2 -wt, G BCL2 -G all → T, or H BCL2 -G10TG12T i-motif-forming templates at different time points. Gels shown in ( F – H ) are representative of three independent biological replicates. Mutations at specific Gs (marked in green) to prevent hairpin formation; pause signals for i-motif formation marked in red and asterisks. I CD titrations with increasing PCBP1 concentrations on BCL2 -G all → T and BCL2 -G10TG12T; blue-shifts and hypochromic effects indicated by blue bars and arrows. J Schematic illustration showing hairpin-forming potential of i-motif significantly slows down PCBP1’s ability to unfold i-motifs. Uncropped and unprocessed gel images corresponding to primer extension assays shown in ( C , F , G , H ) are provided in the .
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: Primer Extension Assay, Labeling, Sequencing, Standard Deviation, Proton NMR
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: Flow cytometry-based analysis of DNA content and cell cycle distribution in A asynchronous and B PCBP1-KD-treated HeLa cells; bar plots showing cell distribution in G 1 , S, and G 2 /M phases. PE-A Phycoerythrin–Area. Results expressed as means ± SD from three biological replicates ( n = 3). C Anti-BrdU dot-blot assay on G 1 /S-synchronized genomic DNA, followed by synchrony release at different time points upto 4 h in control and PCBP1-KD-treated HeLa cells. D Western blot of γH2AX upon 48 h of PCBP1-KD. Si-scrambled siRNA as negative control; β-actin as housekeeping protein. Fold-change increase in γH2AX below the blot. Blots shown are representative of three independent biological replicates. Uncropped and unprocessed images corresponding to dot-blot and western blot experiments shown in ( C , D ) are provided in the . E Schematic illustration of PCBP1-ChIP using PCBP1-specific antibody. Created in BioRender. Sabouri, N. (2026) https://BioRender.com/uvavqla . F Fold enrichment of PCBP1-ChIP at i-motif-containing promoters compared to HTR6 control site in asynchronous (asyn), G 1 /S- and S-synchronized HeLa cells. G Fold enrichment of iMab-ChIP at i-motif-harboring promoters ( cMYC , BCL2 , ILPR ) over non-i-motif control site ( HTR6 ) in asynchronous, G 1 /S- and S-synchronized HeLa cells. ChIP bar plots and error bars in ( F , G ) represented as means ± SD of three technical replicates ( n = 3). Statistical differences and p values determined by one-way ANOVA followed by Tukey–Kramer post hoc test, where p values < 0.05 are considered statistically significant. Raw C t values from input, IP, and mock (IgG) samples obtained from three independent biological replicates, each measured with three technical replicates, are provided in Supplementary Data and . H Relative expression (2 −ΔΔCt ) in i-motif-containing and non-i-motif-containing gene expression upon PCBP1-KD using RT-PCR. Data and error bars represent the mean ± SD from three independent biological replicates ( n = 3). P values calculated using two-tailed Student’s t tests, where p values < 0.05 are considered statistically significant.
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: Flow Cytometry, Dot Blot, Control, Western Blot, Negative Control, Expressing, Gene Expression, Reverse Transcription Polymerase Chain Reaction, Two Tailed Test
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: A Schematic representation of purified wild-type PCBP1 and KH mutants (KH1 + 2 and KH3). KH domains are marked in pink, and the unstructured interconnecting domains are marked in gray. B K D,app from MST binding curves between KH mutants and i-motifs at pH 8.0, 7.0, and 6.4; data represent the mean ± SD from three independent biological replicates ( n = 3). Error bars indicate standard deviation. Statistical significance and p values were calculated using a two-tailed Student’s t -test, where a p value < 0.05 indicates statistically significant results. C CD spectra of cMYC -i-motifs upon titrations of KH1 + 2, KH3, and a combination of KH1 + 2 and KH3, with highlighted regions showing blue-shift (with arrows) and hypochromism. D Native PAGE visualizing hybridization reaction aliquots of cMYC -iMfs in the presence of different combinations of KH mutants at different time intervals up to 14 min, alongside negative control (i-motifs without complementary strands) and positive controls (hybridized duplex). Uncropped and unprocessed gel images corresponding to native PAGE experiments are provided in the . Created in BioRender. Sabouri, N. (2026) https://BioRender.com/oazozsm . E Densitometric analysis of i-motif-trapping. Normalized intensities of hybridized fractions calculated from three independent biological replicates ( n = 3) at different time points, fitted to single-exponential function equations. Error bars indicate standard deviation.
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: Purification, Binding Assay, Standard Deviation, Two Tailed Test, Circular Dichroism, Clear Native PAGE, Hybridization, Negative Control
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: A ITC interaction between a 1:1 mix of KH1 + 2 and cMYC -i-motif in the ITC cell, and KH3 in the syringe at pH 6.4. Top: enthalpic heat released versus time at 25 °C during titrations. Bottom: thermogram of integrated peak intensities against molar ratio. Δ H (enthalpy) and Δ S (entropy) are provided. Data and error bars calculated from mean ± SD from three independent biological replicates ( n = 3). B 1 H NMR spectra showing imino proton resonances (15–16 ppm) of cMYC -i-motif during PCBP1 and KH mutants’ titrations. C Bromine footprinting gel of cMYC -i-motif at pH 6.4 and 7.0 in 1:1-bound complexes of PCBP1, KH1 + 2, KH3, and KH1 + 2 + KH3 at pH 6.4. A + G, C + T ladders, and unreacted cMYC -i-motif, i-motif sequence are shown; Cs within C:CH⁺ and i-motif-core-connecting loops marked with line and round shapes, respectively. Bar plot shows the % of C-cleavage by piperidine upon bromination in the i-motif. An uncropped and unprocessed gel image corresponding to bromine footprinting experiments is provided in the . D Schematic of cMYC -i-motif at pH 6.4, based on bromine footprinting; C:CH⁺ base pairs in first C-tract involving C3–C5 and C12–C14 are destabilized upon KH1 + 2 interactions. E In silico modeled complex of PCBP1-bound partially hemi-protonated ILPR -i-motif with the following modifications: G-to-A at G2, G16, and G30. C-bases in red and violet are unprotonated and protonated, respectively. KH1-3 domains in PCBP1 are in green, sky blue, and yellow, respectively. Potential amino acids in the interactions within the KH1 and KH3 domains are labeled. F During simulation, starting ILPR -i-motif structure at 0 ns and i-motif at 2500 ns of simulation are shown. Inter-residual distances between Cs in ILPR -i-motif base-pairing throughout simulation (b)−1. G Binding mode analysis of PCBP1 with ILPR -i-motif throughout 2500 ns simulations with individual contribution of residues within KH1, KH3, and the unstructured region between KH2 and KH3. The darker the blue color of contact intensity (%), the more the frequency of intermolecular interactions. H Dynamical Cross-correlation Matrix between the atomic displacements considering Cα for protein residues and phosphorus for i-motif residues during simulation (b)−1. Marked violet circles highlight correlated motions between protein domains and part of the i-motif.
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: Footprinting, Sequencing, In Silico, Labeling, Binding Assay
Journal: Nature Communications
Article Title: Mechanistic insights into PCBP1-driven unfolding of selected i-motif DNA at G 1 /S checkpoint
doi: 10.1038/s41467-026-68822-5
Figure Lengend Snippet: PCBP1 binds i-motif DNA with higher affinity than its corresponding single-stranded forms. Upon binding, PCBP1 promotes i-motif unfolding in a manner that depends on both the protonation state of i-motifs and their propensity to form hairpin conformations. I-motifs that exist in equilibrium with hairpin structures remain accessible to PCBP1; however, stable hairpin formation markedly suppresses PCBP1-mediated unfolding. Protonation further modulates the kinetics of this process, with higher protonation states slowing unfolding, whereas lower protonation accelerates the unfolding. Although PCBP1 can associate with single-stranded forms, these interactions are weaker, and i-motif unfolding consequently reduces PCBP1 occupancy at these genomic sites, thereby permitting replication initiation. PCBP1 contains three KH domains—KH1, KH2, and KH3—that act through a hierarchical two-step mechanism. Initial engagement of the i-motif by KH1–KH2 domains induces local structural destabilization, which subsequently recruits the KH3 domain to drive complete unfolding. This PCBP1-mediated spatiotemporal dynamics of i-motifs is proposed to support genomic integrity and cell-cycle progression by facilitating replication initiation and enabling the G 1 /S transition into S phase. Created in BioRender. Sabouri, N. (2026) https://BioRender.com/b3vfrkt .
Article Snippet: PCBP1 knockdown (KD) was performed using
Techniques: Binding Assay
Journal: International Journal of Medical Sciences
Article Title: Circular RNAs in stem cell differentiation: a sponge-like role for miRNAs
doi: 10.7150/ijms.56457
Figure Lengend Snippet: The miRNA sponging by circRNA during post-transcriptional process.
Article Snippet: BIOINF , http://www.bioinf.com.cn/ ,
Techniques:
Journal: International Journal of Medical Sciences
Article Title: Circular RNAs in stem cell differentiation: a sponge-like role for miRNAs
doi: 10.7150/ijms.56457
Figure Lengend Snippet: Online services of circRNA
Article Snippet: BIOINF , http://www.bioinf.com.cn/ ,
Techniques: Expressing, Biomarker Discovery, Functional Assay, Next-Generation Sequencing, Sequencing, Alternative Splicing, Binding Assay
Journal: Aging (Albany NY)
Article Title: Circ-0001068 is a novel biomarker for ovarian cancer and inducer of PD1 expression in T cells
doi: 10.18632/aging.103706
Figure Lengend Snippet: Identification of circRNAs in the serum exosomes from healthy volunteers (HV) and ovarian cancer (OC) patients. Heatmap of circRNAs in serum exosomes from HV and OC patients.
Article Snippet: The primers used for
Techniques:
Journal: Aging (Albany NY)
Article Title: Circ-0001068 is a novel biomarker for ovarian cancer and inducer of PD1 expression in T cells
doi: 10.18632/aging.103706
Figure Lengend Snippet: Significantly upregulated circRNAs in the serum exosomes from ovarian cancer patients.
Article Snippet: The primers used for
Techniques:
Journal: Aging (Albany NY)
Article Title: Circ-0001068 is a novel biomarker for ovarian cancer and inducer of PD1 expression in T cells
doi: 10.18632/aging.103706
Figure Lengend Snippet: The relative levels of circRNAs in the serum exosomes from 10 healthy volunteers (HV) and 10 ovarian cancer (OC) patients. The relative levels of circRNAs in the serum exosomes of the HV and OC patients were determined using qRT- PCR. ***P < 0.001.
Article Snippet: The primers used for
Techniques: Quantitative RT-PCR